/Special landing pages/MGC Vector Pages/Vectors and Maps/pCR-XL-TOPO Cloning Vector
Vectors and Maps > pCR-XL-TOPO Cloning Vector

pCR-XL-TOPO Cloning Vector

transOMIC technologies is the official archiving site for the Mammalian Gene Collection (MGC).

This vector is one of the several expression and cloning vectors found in the MGC premier cDNA, Entry ORF and Lentiviral ORF collections. Select from over 100,000 full-length, sequence guaranteed cDNA and ORF clones targeting human, mouse, rat, bovine, Xenopus and zebrafish genes. Learn More
 
To find cDNA or ORF clones for your gene of interest use the FETCH my gene search tool above. Simply input your RNA accession, gene symbol, alias, gene name or ID to view your results of available products for your gene.

pCR-XL-TOPO Cloning Vector

Alternate Name:

XL Topo

Plasmid Type:

Bacterial Expression

Promoter:

 

Cloning Method:

TOPO Cloning

Size:

3519

Primer Sequence 1:

T7 TAATACGACTCACTATAGGG

Primer Sequence 2:

M13(-21) TGTAAAACGACGGCCAGT

Primer Sequence 3:

M13 reverse CAGGAAACAGCTATGACC

Primer Sequence 4:

                                                                                     

Bacterial Selection:

Kanamycin

Mammalian Selection:

 


pCR-XL-TOPO Cloning Vector


Annotated maps and sequences of vectors are available from the SnapGene website and can be viewed with the free Viewer.
Vectors can be viewed in SnapGene format(), and as GenBank (gb) files.