/Special landing pages/MGC Vector Pages/Vectors and Maps/pCS108 Expression Vector
Vectors and Maps > pCS108 Expression Vector

pCS108 Expression Vector

transOMIC technologies is the official archiving site for the Mammalian Gene Collection (MGC).

This vector is one of the several expression and cloning vectors found in the MGC premier cDNA, Entry ORF and Lentiviral ORF collections. Select from over 100,000 full-length, sequence guaranteed cDNA and ORF clones targeting human, mouse, rat, bovine, Xenopus and zebrafish genes. Learn More
 
To find cDNA or ORF clones for your gene of interest use the FETCH my gene search tool above. Simply input your RNA accession, gene symbol, alias, gene name or ID to view your results of available products for your gene.

pCS108 Expression Vector

Alternate Name:

 

Plasmid Type:

Mammalian Expression

Promoter:

CMV

Cloning Method:

 

Size:

4149

Primer Sequence 1:                                      

T7 TAATACGACTCACTATAGGG

Primer Sequence 2:

T3 GCAATTAACCCTCACTAAAGG

Primer Sequence 3:

Sp6 ATTTAGGTGACACTATAG

Primer Sequence 4:

M13 reverse CAGGAAACAGCTATGACC                                                                      

Bacterial Selection:

Ampicillin

Mammalian Selection:

 
Vector Map

pCS108 Expression Vector


Annotated maps and sequences of vectors are available from the SnapGene website and can be viewed with the free Viewer.
Vectors can be viewed in SnapGene format(), and as GenBank (gb) files.