/Special landing pages/MGC Vector Pages/Vectors and Maps/pOTB7 Cloning Vector
Vectors and Maps > pOTB7 Cloning Vector

pOTB7 Cloning Vector

transOMIC technologies is the official archiving site for the Mammalian Gene Collection (MGC).

This vector is one of the several expression and cloning vectors found in the MGC premier cDNA, Entry ORF and Lentiviral ORF collections. Select from over 100,000 full-length, sequence guaranteed cDNA and ORF clones targeting human, mouse, rat, bovine, Xenopus and zebrafish genes. Learn More
To find cDNA or ORF clones for your gene of interest use the FETCH my gene search tool above. Simply input your RNA accession, gene symbol, alias, gene name or ID to view your results of available products for your gene.

pOTB7 Cloning Vector

Alternate Name:

 

Plasmid Type:

Bacterial Expression

Promoter:

 

Cloning Method:

 

Size:

1815

Primer Sequence 1:

T7 TAATACGACTCACTATAGGG

Primer Sequence 2:

Sp6 ATTTAGGTGACACTATAG

Primer Sequence 3:

M13(-21) TGTAAAACGACGGCCAGT

Primer Sequence 4:

M13 reverse CAGGAAACAGCTATGACC

Bacterial Selection:

Chloramphenicol

Mammalian Selection:

 
Vector Map

pOTB7 Cloning Vector


Annotated maps and sequences of vectors are available from the SnapGene website and can be viewed with the free Viewer.
Vectors can be viewed in SnapGene format(), and as GenBank (gb) files.